---
title: "Prostasin (Prss8) loss disrupts embryonic erythropoiesis and yolk sac vascular remodeling"
id: "plos-one-7-impaired-erythroid-maturation-in-murine-embryos-upon-loss-of-the-preeclampsia"
canonical_url: "https://medichelpline.com/clinical-feed/plos-one-7-impaired-erythroid-maturation-in-murine-embryos-upon-loss-of-the-preeclampsia"
content_type: "clinical_feed_article"
specialty: "Hematology"
source_name: "PLOS ONE (Medicine)"
source_url: "https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0360958"
published_at: "2026-10-16T14:00:00.000Z"
evidence_level: "Journal Feed"
license: "CC-BY-NC-4.0 / Informational Use"
---
# Prostasin (Prss8) loss disrupts embryonic erythropoiesis and yolk sac vascular remodeling
## Provenance & Clinical Metadata
- **Canonical URL:** https://medichelpline.com/clinical-feed/plos-one-7-impaired-erythroid-maturation-in-murine-embryos-upon-loss-of-the-preeclampsia
- **Specialty:** [Hematology](https://medichelpline.com/clinical-feed/hematology.md)
- **Primary Source:** PLOS ONE (Medicine)
- **Source URL:** [Original Journal Publication](https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0360958)
- **Published At:** 2026-10-16T14:00:00.000Z
- **Evidence Rating:** Journal Feed
## Executive GIST (TL;DR)
- Investigators compared Prss8 +/+ (wild-type) and Prss8 -/- (knockout) murine embryos to probe prostasin’s role during embryogenesis. - The Prss8 -/- cohort showed embryonic lethality by E14.5; embryos were analyzed at E9.5–E12.5 for hematopoietic and vascular phenotypes. - Flow cytometry, imaging flow cytometry, histology, CFU assays, bulk and single-cell RNA sequencing were applied to yolk sac, placenta, AGM and fetal liver samples. - The study team observed reduced frequencies of circulating **primitive erythroblasts** and EMP-derived definitive erythroblasts in yolk sac, placenta and fetal liver at E11.5–E12.5 in Prss8 -/- embryos. - Single-cell RNA-seq of primitive erythroid cells from Prss8 -/- embryos indicated downregulation of **fetal hemoglobin** genes and upregulation of ribosomal genes, a transcriptomic signature compatible with defective terminal maturation. - Prostasin expression was absent in circulating erythroid cells, leading authors to propose a cell-extrinsic regulatory mechanism for erythropoiesis. - Yolk sac vascular patterning was altered in knockouts, with reduced vessel branching and junctions; the authors link this vascular remodeling defect to impaired placental vascularization and embryonic demise. - The RNA sequencing datasets were deposited in GEO (accessions GSE275398 and GSE275399). - The source did not report in vivo biochemical confirmation of prostasin’s effect on ENaC within embryonic tissues, nor did it present human clinical correlates beyond prior genetic associations to preeclampsia.
## Clinical Analysis & Structured Key Points
Impaired erythroid maturation in murine embryos upon loss of the preeclampsia-associated serine protease prostasin Prostasin loss impairs erythropoiesis | PLOS One Browse Subject Areas ? Click through the PLOS taxonomy to find articles in your field. For more information about PLOS Subject Areas, click here . Article Authors Metrics Comments Media Coverage Peer Review Reader Comments Figures Figures Abstract In humans, the membrane-bound serine protease prostasin encoded by Prss8 is associated with preeclampsia, a gestational hypertension disorder affecting blood supply of the placenta. Deficiency of Prss8 in mice resulted in embryonic lethality by embryonic day (E) 14.5 and impaired maturation of placental labyrinth. We found in Prss8 -/- embryos at E11.5 and E12.5 a reduced frequency of both circulating primitive and erythro-myeloid progenitor (EMP)-derived definitive erythroblasts in the yolk sac, placenta and fetal liver. Single-cell RNA sequencing analyses revealed a downregulation of fetal hemoglobin genes and an upregulation of ribosomal genes in primitive erythroid cells of Prss8 -/- embryos, indicating a defective erythroid maturation. We suggest that prostasin regulates primitive erythropoiesis in a cell-extrinsic manner, since its expression was absent in circulating erythroid cells. Indeed, the yolk sac vascular remodeling of Prss8 -/- embryos was impaired as evidenced by reduced vessel branching and junctions, likely affecting placenta vascularization and contributing to embryonic demise. Our findings unveil a novel role for prostasin during developmental erythropoiesis and vascular patterning and provide insight into how Prss8 dysregulation may contribute to placental pathologies such as preeclampsia. Citation: Di Carlo S, Salas-Bastos A, Castelblanco Castelblanco M, Auberson M, Wang D, Rumpler M, et al. (2026) Impaired erythroid maturation in murine embryos upon loss of the preeclampsia-associated serine protease prostasin Prostasin loss impairs erythropoiesis. PLoS One 21(10): e0360958. https://doi.org/10.1371/journal.pone.0360958 Editor: Michael Schubert, Laboratoire de Biologie du Développement de Villefranche-sur-Mer, FRANCE Received: February 26, 2026; Accepted: October 2, 2026; Published: October 16, 2026 Copyright: © 2026 Di Carlo et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: The RNA sequencing data from this study have been deposited in the GEO data repository under the accession numbers GSE275398 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE275398 ) and GSE275399 ( https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE275399 ). Funding: This research has been funded by Swiss National Science Foundation (SNSF grant 31003A-182478/1 and 31003A-163347) to E.H., and SNSF grants PZ00P3_223607 / 1 to A.J.S. and 320030-231787 to O.N., and 223607 to Gabriela Desdín-Micó, as well as UNIL funds. The funders of this project had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Introduction Proteases, and especially serine proteases, have a pivotal role in signaling processes and are thus fundamental to survival across all living organisms [ 1 ]. Serine proteases represent the largest family of proteolytic enzymes and control several physiological processes including epithelial development, digestion, blood coagulation, inflammation and immunity. Likewise, there is growing evidence of their contribution to the pathogenesis of inflammatory and neoplastic diseases [ 2 , 3 ]. Prostasin is a glycosyl-phosphatidylinositol membrane-anchored serine protease expressed in the epithelial compartment of most tissues, including prostate, lung, kidney, colon and skin, where it was shown to play a tissue-specific role [ 4 – 6 ]. Prostasin was the first among many membrane-anchored serine proteases to be described as an activator of the epithelial Na + channel (ENaC) [ 7 – 9 ], thereby also named channel-activating protease 1 (CAP1). While ENaC was found to be proteolytically cleaved by prostasin in in vitro experiments [ 10 – 12 ], this has not yet been confirmed in vivo [ 13 ]. Namely, prostasin has been shown to elicit a variety of non-proteolytic functions in vivo , such as epidermal barrier function and skin inflammation [ 6 , 14 , 15 ]. Consequently, both prostasin overexpression and downregulation have been linked to the onset of several diseases, including hypertension and cancer [ 16 – 21 ]. More recently, prostasin was also found to be dysregulated in females in a sex-specific manner and associated to coronary microvascular dysfunction in patients with heart failure [ 22 ]. Interestingly, a single nucleotide polymorphism (SNP) of Prss8 (rs12597511) in women has been linked to preeclampsia, a severe form of hypertension during pregnancy, leading to impaired placentation and premature embryonic death [ 23 , 24 ]. Previous studies described a role of prostasin in human trophoblast differentiation, although its implication in embryonic development has not yet been extensively investigated [ 25 – 28 ]. During embryonic development in mammals, erythropoiesis results in the rapid production of erythroid cells that support the growth and survival of the embryo and fetus [ 29 ]. Three waves of erythropoiesis have been described to occur in the murine embryo. The first one, prior to the onset of embryonic circulation at E7.5 and to the establishment of the hematopoietic system, is called “primitive” and takes place in the yolk sac giving rise to mature red blood cells (RBCs), megakaryocytes and macrophages [ 30 , 31 ]. Concurrently, the second wave of multipotent hematopoietic progenitor cells, termed “erythro-myeloid progenitors” (EMP) [ 32 , 33 ] emerges in the yolk sac and serves as major source of HSC-independent hematopoiesis in the developing embryo [ 34 ]. Bona fide hematopoietic stem cells (HSCs) capable of producing all lympho-myeloid lineages arise only at late embryonic/early fetal stage of development (E10.5 - E11.5) and derive from hemogenic endothelium in the major intra- and extraembryonic arteries including the AGM and placenta. This third wave supplies adult-type erythrocytes and is thus referred to as “definitive” erythropoiesis [ 29 ]. While primitive erythrocytes enter circulation in their nucleated form when the heartbeat starts and enucleate in the bloodstream between E12.5 and E16.5, both EMP-derived and HSC-derived definitive erythrocytes circulate exclusively as enucleated cells and mature extravascularly in the fetal liver or subsequently in the bone marrow [ 35 ]. However, the complex nature of these processes has only been elucidated in the past decades, and the precise origin of the different erythropoietic waves remains still debated [ 36 – 38 ]. In this study, we aimed to explore the physiological role of prostasin in murine embryos prior to their premature death by comparing the phenotype and transcriptome of Prss8 +/+ (WT) to Prss8 -/- (KO) embryos. Due to the previously observed defect in vascularization and suspected impaired blood supply of the placenta, we focused on the main hematopoietic tissues including yolk sac, AGM, fetal liver and placenta. Our data demonstrated that lack of prostasin led to a reduction of primitive erythroblasts and significant transcriptomic variation in these cells. The downregulation of fetal hemoglobin genes at E11.5 in the embryo proper was associated with aberrant terminal maturation of primitive erythroid cells. Overall, this resulted in the impaired vessel remodeling of the yolk sac at E12.5 and embryonic lethality. Finally, our findings unwrap new research perspectives on the physiological role of prostasin as well as on the regulation of embryonic erythropoiesis. Methods Mice The generation of mice carrying one knockout allele of Prss8 has been described previously [ 39 ]. Prss8 -/- and Prss8 +/+ embryos were generated by intercrossing Prss8 +/- mice. Mating was started in the evening, and females were checked for vaginal plugs the next morning, with the morning of plug defined as E0.5. Pregnant mice were sacrificed at E9.5, E10.5, E11.5 and E12.5 and euthanasia was achieved by pentobarbital injection (adults) or decapitation (embryos). Embryos were collected for the analysis of yolk sac, AGM, fetal liver or placenta. The viability of embryos was assessed by heart beating and/or gross morphology. Genotyping of Prss8 was performed by PCR using the following primers for Prss8 (sense 1: 5’- GCAGTTGTAAGCTGTCATGTG-3’; antisense: 5’- TCCAGGAAGCATAGGTAGAAG-3’, sense 2: 5’- CAGCAGCTCGAGGTACCACTC −3’). All animal experiments in this study were conducted according to Swiss guidelines with approval of the cantonal authorities (Service de la consommation et des affaires vétérinaires, Etat de Vaud, authorization numbers VD3812a-c). The mice were kept in an approved animal care facility of the University of Lausanne with free access to food (standard diet, SD, 0.25% Na+ and 0.70% K+) and tap water. Single cell suspension Cells from yolk sac, AGM or fetal liver were isolated by placing each organ in one 24-well with 300 µL of dissociation medium (1 mg/ml dispase-collagenase in PBS + 5 mM Ca 2+ ) at 37°C for 40–45 minutes. The tissues were gently crushed every 10 min using a 1000 µL pipette until complete tissue disruption. The cell suspension was collected and passed through a 40 µm cell strainer (Greiner Bio-One). The cell suspension was centrifuged at 1200 rpm for 5 minutes and resuspended in PBS + 10% FCS. FACS analysis The single cell suspension was stained with following antibodies: FITC Ter-119 (1:500; 557915, BD Pharmingen); PE/Cy7 CD71 ab (1:200; 113812, BioLegend); FITC CD41 ab (1:200; 561849, BD Pharmingen); PE/Cy7 CD43 ab (1:100; 121218, BioLegend); BUV737 CD45.2 ab (1:100; 1313859, BD Horizon); PE CD31 ab (1:200; 12-0311-82, Invitrogen); A700 c-kit ab (1:200; 56-1172-82, Invitrogen); live/dead aqua staining (1:1000; L34957 Invitrogen). Other antibodies used for macrophages, neutrophils, NK cells, T- and B- cells were the following: BV650 CD3e (1:500; AB_2738779, BD Horizon); FITC NK-1 (1:200; AB_394676, BD Pharmingen); PerCP/Cy5.5 CD11c (1:200; 117328, BioLegend); BV421 CD11b (1:100; 101251, BioLegend); PE-texas red F4/80 (1:500; AB_10372055, Invitrogen); APC/Cy7 Ly6G (1:500; 560600, BD Pharmingen); BV711 B220 (1:200; AB_2738470, BD Horizon). Fluorescent signal was recorded from BD LSRFortessa with the BD FACSDiva software. Single color controls for each fluorochrome were acquired to generate the compensation matrix that was applied to all the experimental files prior to analysis with FlowJo software (Version 10.8.1). Gating strategy for pre-HSCs and hemogenic endothelium was performed as in [ 40 ]. Imaging flow cytometry Samples were acquired on a 2 camera, 12 channel ImageStreamX imaging flow cytometer (Cytek Biosciences) at low speed and highest magnification (60X). Cells were excited using a 405 nm laser (25mW), a 488 nm laser (150mW), a 561 nm laser (150mW), a 642 nm laser (120mW) and a 785nm Side Scatter (SSC) laser (3 mW). Only events with a bright field area greater than 1 µm² (to exclude cell debris) and non-saturating pixels (Raw max pixel values below 4096) were collected. Data was acquired for at least 10000 events/sample. Experimental samples contained images for bright field (Channels 1 and 9), Ter119-FITC (Channel 2), CD71-PECy7 (Channel 6), Hoechst 33342 (Channel 7), and Side Scatter (Channel 12). The antibodies used are the same as listed in the section “FACS analysis”. Single color controls for each fluorochrome were acquired to generate the compensation matrix that was applied to all the experimental files prior to analysis using IDEAS (Image Data Exploration and Analysis Software) 6.2 software (Cytek Biosciences). For the data analysis of placenta and yolk sac, we first selected erythrocyte populations based on Ter119 and Hoechst. Then, Ter119 + Hoechst + cells were selected based on CD71 higher intensity to 10 4 . Moreover, cell images were analyzed to confirm cell morphology and staining diffusion. Dead cells had high diffusion of Ter119 and CD71 antibodies, suggestive of membrane permeability. For the data analysis of fetal liver samples, we referred to a previous publication [ 41 ]. Histology Following dissection, yolk sac and placenta were fixed overnight in 4% PFA and embedded in paraffin. 4 µm paraffin sections were stained with H&E to assess the general morphology. The staining was performed on the Sakura Tissue-Tek Prisma® Plus Automated Slide Stainer linked to the Tissue-Tek® Glas™ g2 Automated Glass Cover slipper. Images were acquired using the Zeiss Axioscan 7 microscope with a resolution of 40X. For the collection of circulating erythroid cells, vitelline and umbilical arteries were cut in 300 µL PBS + 0.01% Heparin in a 48 well plate. Then embryonic blood cells were collected from each well for Giemsa staining and visualized using the HSP-1000 high resolution microscope. The yolk sac was placed in 4% PFA overnight. After 24 hours, the tissue was washed 3x with PBS and blocked at RT in staining buffer (PBS + 0.3% Triton-X + 3% BSA) for 1h. It was then stained with anti-mouse CD31 (1:500; 553370, BD Bioscience), anti-rat Ter119 (1:200; 14-5921-82, Invitrogen) and anti-mouse VE-Cadherin (1:200; AF1002, R&D systems) antibodies overnight, followed by incubation with secondary antibodies for 1h at RT. Finally, the yolk sac was placed in mounting medium containing 4% DAPI on a glass slide and flat opened for microscopic analysis. Whole mount images were taken using a Nikon Ti2 spinning disk microscope with a resolution of 40X. Western blotting Embryonic tissues were collected into 2 ml Eppendorf tubes, flash frozen in liquid nitrogen, and stored at −80°C. For protein extraction, we used the following extraction buffer: TrisHCl pH7.5, 50mM; EDTA 1mM; EGTA 1mM; sucrose 0.27M plus protease inhibitors (complete, Roche # 11836145001) and phosphatase inhibitors (phosSTOP, Sigma # 04 906 837 001). 100 µl was added directly to the tubes containing the tissues. Tissues were then homogenized with a bead mixer for 1.5 min and incubated for 30 min on ice. Protein homogenates were centrifuged at 13000 rpm for 15 minutes at 4°C, supernatants were then transferred in new tubes and protein concentration was measured using the Bradford assay. For WB, 15 µg of protein was used for each condition, boiled for 10 min at 95°C before loading on 4–15% Criterion TGX Precast Midi Protein Gel (Bio-Rad 5671085). Proteins were separated for 2h at 100V and then transferred to nitrocellulose membranes for 2.5h at 100V using a wet transfer apparatus (Bio-Rad). Membranes were blocked for 1h in 2% milk, prepared with PBS, and incubated with the following primary antibodies overnight at 4°C: Anti-prss8 (15527–1-AP, proteintech), Anti-β-Actin (1:500, mouse monoclonal, A1978-200UL, sigma), Anti-Tubulin (1:10000, mouse monoclonal, T5201-200UL, sigma). Secondary antibodies were applied for 1h at room temperature: Peroxidase-conjugated AffiniPure Goat Anti-Rabbit IgG (H + L) (111-035-144, Jackson Immuno Research), 1:5000 Peroxidase-conjugated AffiniPure Goat Anti-Mouse IgG (H + L) (115-035-003, Jackson Immuno Research), 1:5000. WesternBright Quantum – HRP Substrate - 200mL, K-12042-D20, Witec. Colony Forming Unit (CFU) assay Single cell suspension was obtained as described previously and cells were counted and diluted to a final concentration of 5 x 10 5 cells/mL. Then, 250 µL of cell suspension was added to 2.5 mL of MethoCult GF M3434 (3434, Stem Cell Technologies) or SF M3436 medium (3436, Stem Cell Technologies) and 1.1 mL/well was plated in duplicate in a SmartDish™ 6-well culture plate (27370, Stem Cell Technologies). Water was added into empty wells to minimize the medium evaporation. The read out was performed after 8 days of culture with the StemVision automated microscope (Stem Cell Technologies). Each dot represents the average of the two technical replicates. For the fetal liver derived cells, an extra plate was seeded with a third of the whole tissue single cell suspension to determine total number of CFUs per FL cells. After 7 days of culture in M3434, the full content of each well was recovered and methylcellulose removed by 5x washing with PBS + 10% FCS. Cells were then centrifuges at 1200 rpm for 5 minute and stained for FACS analysis as described using the following antibodies: FIT CD71 (1:200; 561849, BD Pharmingen), APC Gr1 (1:200; 304102, Biolegend) and APC F4/80 (1:200; 304099, Biolegend), AF700 Ter119 (1:500; 304128, Biolegend), BV412 CD41 (1:200; 133911, Biolegend), BUV395 CD45 (1:200; 564279, BD). Quantitative reverse transcription PCR (qRT-PCR). Tissues were flash frozen at −80°C after dissection. For RNA extraction, the tissue was disrupted using metallic balls and TissueLyser at 30 mut/sec for 15 seconds and RNA was isolated using the RNeasy Midi Kit (75144, Qiagen). RNA quality was assessed using Nanodrop spectrometry and 1 µg of RNA was converted into cDNA using the PrimeScript RT reagent kit (Perfect Real Time) (RR037A, Takara) according to manufacturer’s instructions. Gene expression was determined using SYBER Green detection system and the following primers, Prss8 : For, 5’- TGACCATTCTGCTCCTTCTC-3’, Rev, 5’- GACACCACCCATTTATTTGAC-3’; Gapdh : For, 5’- CCACCCAGAAGACTGTGGAT-3’, Rev, 5’- CACATTGGGGGTAGGAACAC-3’. Controls using RNA-free water were negative for targets and housekeeping genes. Fold change was calculated using ΔCt method with Gapdh as an internal standard and then calculating the ΔΔCt comparing the expression in the AGM to the yolk sac. Bulk RNA-sequencing RNA was extracted as for qRT-PCR and RNA quality was assessed on a Fragment Analyzer (Agilent Technologies). The RNAs had RQNs between 8.7 and 10. RNA-seq libraries were prepared from 500 ng of total RNA with the Illumina TruSeq Stranded mRNA reagents (Illumina). Library preparation was performed on a Sciclone liquid handling robot (Revvity) using the provided automated script. Unique dual indexes were used for barcoding of the libraries. Libraries were quantified by a fluorometric method (QubIT, Life Technologies) and their quality assessed on a Fragment Analyzer (Agilent Technologies). Sequencing was performed on an Illumina NovaSeq 6000. Sequencing data were demultiplexed using the bcl2fastq2 Conversion Software (version 2.20, Illumina). Single-cell (sc) RNA-sequencing sample processing A Chromium Next GEM Chip G (10X genomics) was loaded with the appropriate number of cells, and the sequencing libraries prepared with the Chromium Single Cell 3’reagent kit v3.1 dual index, strictly following the manufacturer’s recommendations. Briefly, an emulsion encapsulating single cells, reverse transcription reagents and cell barcoding oligonucleotides was generated. After the actual reverse transcription step, the emulsion is broken and double stranded cDNA generated and amplified in a bulk reaction (12 PCR cycles). This cDNA was fragmented, a P7 sequencing adaptor ligated, and a 3’ gene expression library generated by PCR amplification (13 cycles). Libraries were quantified by a fluorometric method, and their quality assessed on a Fragment Analyzer (Agilent Technologies). Sequencing was performed on Illumina NovaSeq 6000 v1.5 flow cells for 28-10-10-90 cycles (read1 – index i7 - index i5 - read2) with 1% PhiX spike in. Statistical analysis The data shown are mean ± SEM of at least three biological replicates. Comparison between two or more groups was performed by two-tailed t test and values with P < 0.05 were considered statistically significant. All representations and statistical analyses were d
## Related Clinical Research

- [Endothelial dysfunction and platelet activation in systemic sclerosis–related pulmonary hypertensi](https://medichelpline.com/clinical-feed/plos-one-22-endothelial-and-platelet-dysfunction-in-systemic-sclerosis-with-pulmonary.md)
- [Young-onset stroke in the UAE: risk factors, subtypes, and outcomes from a single-centre study](https://medichelpline.com/clinical-feed/plos-one-19-young-onset-stroke-in-the-uae-a-single-centre-retrospective-analysis-of-risk.md)
- [Combined Aspirin and Low Molecular Weight Heparin for Preeclampsia Prevention in High-Risk Gravi](https://medichelpline.com/clinical-feed/clinicaltrials-nct07361679.md) (DOI: NCT07361679)
- [CKM Burden Predicts Echocardiographic Recovery and Cardiovascular Events in Hypertension](https://medichelpline.com/clinical-feed/medrxiv-6-impact-of-cardiovascular-kidney-metabolic-burden-on-echocardiographic.md)
- [Phenome-Wide Clinical Atlas Linking Obstructive Sleep Apnea to Multidomain EHR Signals](https://medichelpline.com/clinical-feed/medrxiv-18-a-clinical-atlas-for-phenome-wide-association-study-of-obstructive-sleep-apnea.md)

## Navigation
- [← Back to Hematology Feed](https://medichelpline.com/clinical-feed/hematology.md)
- [← All Clinical Specialties](https://medichelpline.com/clinical-feed.md)
## Medical & Regulatory Disclaimer

> [!CAUTION]
> MedicHelpline content is structured for research, educational, and professional discovery purposes. It does not constitute individual medical advice, clinical diagnosis, or treatment recommendations.
> Always verify dosing, contraindications, and regulatory alerts against official product labeling and primary regulatory sources before clinical decision-making.