---
title: "Antibiotic‑Resistant and Heavy Metal–Tolerant Bacteria in Batissa violacea from Fiji’s Ba River"
id: "plos-one-20-antibiotic-resistant-pathogens-and-heavy-metal-tolerant-bacteria-in-batissa"
canonical_url: "https://medichelpline.com/clinical-feed/plos-one-20-antibiotic-resistant-pathogens-and-heavy-metal-tolerant-bacteria-in-batissa"
content_type: "clinical_feed_article"
specialty: "Infectious Disease"
source_name: "PLOS ONE (Medicine)"
source_url: "https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0359203"
published_at: "2026-09-25T14:00:00.000Z"
evidence_level: "Journal Feed"
license: "CC-BY-NC-4.0 / Informational Use"
---
# Antibiotic‑Resistant and Heavy Metal–Tolerant Bacteria in Batissa violacea from Fiji’s Ba River
## Provenance & Clinical Metadata
- **Canonical URL:** https://medichelpline.com/clinical-feed/plos-one-20-antibiotic-resistant-pathogens-and-heavy-metal-tolerant-bacteria-in-batissa
- **Specialty:** [Infectious Disease](https://medichelpline.com/clinical-feed/infectious-disease.md)
- **Primary Source:** PLOS ONE (Medicine)
- **Source URL:** [Original Journal Publication](https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0359203)
- **Published At:** 2026-09-25T14:00:00.000Z
- **Evidence Rating:** Journal Feed
## Executive GIST (TL;DR)
- The study surveyed microbial communities in the freshwater bivalve **Batissa violacea** (kai) and adjacent sediments from three sites along the Ba River, Fiji, chosen for varying proximity to industrial and urban inputs. - Samples included 90 bivalves (30 per site) and 15 pooled sediment samples; tissues (soft tissue and gills) were dissected and processed for culture-based analyses and 16S rRNA sequencing. - Total aerobic bacterial counts were highest in bivalve soft tissues (7.9 × 10^3 to 2.2 × 10^4 cfu/g), lower in gills (3.4 × 10^3 to 1.4 × 10^4 cfu/g), and lowest in sediments (2.6 × 10^4 to 2.9 × 10^4 cfu/g); Site 1 (near sugar‑mill effluent) showed the greatest contamination. - Pathogenic taxa isolated included **Vibrio cholerae**, **Vibrio parahaemolyticus**, **Salmonella spp.**, and thermotolerant **Escherichia coli**; Vibrio spp. loads were highest in soft tissue at Site 1. - Most isolates exhibited multidrug resistance, especially to rifampicin, vancomycin, penicillin, streptomycin, and tetracycline, indicating a public‑health risk linked to consumption of raw or lightly cooked kai. - Heavy metal (Zn, Cu, Cd, Cr, Pb) tolerance testing showed generally limited microbial resistance, primarily detectable at the lowest tested concentration (1 mM); higher concentrations yielded little tolerance. - Methods combined culture‑based enumeration (MPN, CFU), selective media for pathogens, antibiotic and heavy metal agar dilution assays, and 16S rRNA gene sequencing for taxonomic identification. - The authors highlight co‑selection concerns: environmental heavy metal contamination may facilitate persistence and horizontal transfer of antibiotic resistance genes on mobile elements, though detailed genetic linkage data were not reported. - Findings underscore risks to ecosystem and food safety for communities relying on kai and call for integrated environmental management and targeted interventions to reduce contamination and AMR spread.
## Clinical Analysis & Structured Key Points
Antibiotic-resistant pathogens and heavy metal-tolerant bacteria in Batissa violacea: A study from the Ba River, Fiji | PLOS One Browse Subject Areas ? Click through the PLOS taxonomy to find articles in your field. For more information about PLOS Subject Areas, click here . Article Authors Metrics Comments Media Coverage Peer Review Reader Comments Figures Figures Abstract The Ba River in Fiji is a critical livelihood source for bivalve harvesters, yet increasing anthropogenic activities threaten the safety of its aquatic food sources. This study comprehensively examines the microbial communities associated with freshwater bivalves ( Batissa violacea ) and river sediments, focusing on antibiotic resistance and heavy metal (HM) tolerance. Samples from soft tissues, gills, and sediments were subjected to Most Probable Number (MPN) tests, antibiotic susceptibility assays, HM tolerance analysis, and 16S rRNA gene sequencing to identify microbial taxa and their functional characteristics. Several pathogenic bacteria were isolated and identified, including Vibrio cholerae , Vibrio parahaemolyticus , Salmonella spp., and thermotolerant Escherichia coli . Most isolates exhibited multidrug resistance, particularly against rifampicin, vancomycin, penicillin, streptomycin, and tetracycline, posing potential risks to public health and food safety. Conversely, HM tolerance analysis revealed limited microbial resistance to zinc, copper, cadmium, chromium, and lead, predominantly at concentrations of 1 mM. The presence of these antibiotic-resistant and HM-tolerant microbes underscores the critical interplay between environmental contamination and microbial evolution, presenting challenges for both ecosystem health and human consumption safety. The findings highlight the urgent need for integrated environmental management and interventions to mitigate microbial contamination in aquatic systems. Citation: Mala DD, Singh AA, Subramani R, Srinivasan S, Taufa T, Kumar A, et al. (2026) Antibiotic-resistant pathogens and heavy metal-tolerant bacteria in Batissa violacea : A study from the Ba River, Fiji. PLoS One 21(9): e0359203. https://doi.org/10.1371/journal.pone.0359203 Editor: Md Rajib Sharker, PSTU: Patuakhali Science and Technology University, BANGLADESH Received: February 13, 2026; Accepted: September 8, 2026; Published: September 25, 2026 Copyright: © 2026 Mala et al. This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability: All relevant data are within the manuscript and its Supporting Information files. Funding: This work was funded as a research project by the University of the South Pacific. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing interests: The authors have declared that no competing interests exist. Importance The Ba River in Fiji is a vital resource for communities dependent on “kai” (freshwater bivalve) harvesting. However, industrial, agricultural, and domestic waste discharge increasingly contaminate the river, raising concerns about the safety of its aquatic resources. This study investigated the microbial communities associated with these bivalves and the river sediments, specifically examining their resistance to antibiotics and tolerance to heavy metals. The findings revealed the presence of several pathogenic bacteria, including Vibrio and Salmonella species, a significant proportion of which exhibited resistance to commonly used antibiotics. While some microbial tolerance to heavy metals such as copper and lead was observed, it remained generally limited. These results suggest that environmental pollution is likely contributing to the spread of antibiotic-resistant and potentially harmful microorganisms, thereby posing a risk to the ecological health of the river, the bivalve populations, and the well-being of the local communities that rely upon them. Introduction In Pacific Island countries (PICs), where seafood is foundational to both diet and culture, bivalves represent a primary food source, especially in Fiji. While bivalve production has grown substantially [ 1 ], aquatic environments are increasingly strained by anthropogenic pollution [ 2 ]. Rising faecal contamination, in particular, poses a serious threat to food safety [ 3 , 4 ]. As filter feeders, bivalves process vast quantities of water, leading to bioaccumulation of faecal pathogens [ 5 ], such as Escherichia coli , Faecal Streptococci , and Klebsiella spp., which can cause acute intestinal illnesses [ 6 ]. Consequently, E. coli and faecal coliforms serve as standard indicators for sanitary quality seafood and water [ 7 , 8 ]. Given that bivalves are traditionally consumed raw or lightly cooked with viscera intact, they represent a high-risk vector for outbreaks of typhoid fever, cholera, and hepatitis [ 9 ], often linked to Vibrio species [ 10 , 11 ]. Beyond microbial threats, bivalve safety is further undermined by chemical pollutants, specifically heavy metals. While naturally present in trace amounts, metal concentrations have surged due to mining, agricultural runoff, and industrial waste discharge [ 12 , 13 ]. These metals persist in the environment and bioaccumulate within the food chain and concentrate in bivalve tissues, posing long-term health risks to human consumers [ 14 – 17 ]. Interestingly, several bacteria have acquired metal resistance genes (MRGs) to survive heavy metal exposure, allowing them to tolerate and even flourish in these toxic conditions [ 18 ]. Similarly, antimicrobial resistance (AMR) is driven by the extensive use and misuse of antibiotics, leading to the rise of microbes that are resistant to current prescribed antibiotics [ 19 ]. Recent studies reveal a compelling correlation between metal tolerance and antibiotic resistance through a process known as co-selection [ 20 , 21 ]. This is attributed to the fact that the metal resistance genes (MRGs) and the antibiotic-resistant genes (ARGs) are often located on the same mobile genetic elements (plasmids, integrons, and transposons), so heavy metal pressure can drive the persistence and horizontal transfer of AMR, even in the absence of antibiotics [ 21 , 22 ]. This phenomenon significantly accelerates the spread of multi-drug resistance pathogens in contaminated aquatic environments, presenting a complex and escalating challenge to global public health. Batissa violacea , known locally as “kai”, is Fiji`s only known freshwater bivalve. Harvested from the major rivers, it serves as a crucial protein source, a rich supplier of essential minerals (including calcium, potassium, zinc, and iron) [ 23 ], and a vital economic asset for local communities [ 24 ]. The freshwater kai fishery is a key contributor to Fijian households and the local economy, with annual market sales reaching an estimated 2,526 tonnes, generating approximately FJD $2.2 million [ 25 ]. Despite its socio-economic importance, research on the microbial safety of freshwater bivalves in the Pacific region, particularly in Fiji, remains significantly limited. This study addresses this critical data gap by investigating the microbial communities associated with Batissa violacea and its surrounding sediments in the Ba River. By integrating traditional culture-based methods with high-resolution 16S rRNA gene sequencing, this research ensures precise taxonomic identification of the resident bacteria. Furthermore, by comparing bacterial concentrations across the bivalve`s soft tissues, gills, and river sediments, this study offers a comprehensive understanding of the contamination pathway. Finally, we evaluate the antibiotic resistance and heavy metal tolerance profiles of the isolated strains, highlighting the potential public health risks for local communities that rely on these bivalves as a primary food source. Materials and methods Sample collection Sites. This study was conducted along the Ba River, located in the Western Division on the main Island of Viti Levu, Fiji ( Table 1 ). The river flows through Ba town and has a total length of approximately 22 km and a maximum water depth of 8 m [ 26 ]. Traditional local protocol ( sevusevu ) was followed to obtain sampling permission from local communities that own and manage the river. Three sites were selected for sample collection ( Fig 1 ). Site 1 was situated 1.8 km upstream from Site 2 and was located behind the Rarawai sugar mill. This site was selected to assess the impact of industrial waste deposition. Site 2, located under the Yalalevu Bridge, was chosen due to its proximity to Ba town and being a common place for harvesting B. violacea (kai). Site 3 was situated 4.8 km upstream from Site 1 at the Vaqia River, selected as a control or pristine environment due to its distance from urban and industrial influences. The samples were collected from three distinct sites to capture environmental variability associated with upstream, downstream, and effluent-impacted conditions. Download: PNG larger image TIFF original image Table 1. Physiochemical properties and sediment and water samples from different sites and location description. TL – Top left, TR – Top right, C – Center, BL – Bottom left, BR – Bottom right. https://doi.org/10.1371/journal.pone.0359203.t001 Download: PNG larger image TIFF original image Fig 1. Map of sampling sites location for collection of bivalves ( Batissa violacea ) and sediment samples along the Ba River, situated in the Ba province in the north-eastern section of the main Island of Viti Levu in Fiji. Site 1 is behind the Rarawai Sugar Mill and near Ba town, Site 2 is further downstream, and Site 3 is a supposedly pristine site, upstream of Rarawai mill and Ba town. ( Photo credit: Divya Darshika Mala ). https://doi.org/10.1371/journal.pone.0359203.g001 Sampling. A total of 90 bivalve samples (30 bivalves per site) and 15 sediment samples (5 pool samples per site) were collected. This sample size allowed the detection of consistent microbial patterns across sites while minimizing sampling bias. All samples were transported to the laboratory in an ice box within 5 hrs of collection and preserved at −20 ˚C until required. All aseptic techniques were strictly followed during the entire sample collection to prevent cross contamination. Sediment samples were collected using 10 m × 10 m quadrat. About 100 g of sediment sample was collected from the four corners and the centre using a grab sampler. The samples from each site were pooled for microbiological study [ 27 ]. Physical parameters, including pH and temperature of both water and sediment samples were measured with standard procedure and recorded in situ for each respective site ( Table 1 ). Bacteriological study Aerobic bacteria. Bivalve samples ( n = 10) of similar size (5–9 cm shell length) were aseptically dissected to extract soft tissues and gills. A 10 g of each tissue sample (soft tissue and gill) was homogenized in 90 mL of sterilized phosphate buffer (PB; pH 7.0) using a homogenizer (BioLab, New Zealand), resulting in a 10 − ¹ dilution. The homogenate was serially diluted up to 10 − ⁷ using 9 mL of sterile PB. From each dilution, 100 µL was plated on plate count agar (PCA; Difco, USA) using the spread plate method and incubated at 37 °C for 24–48 hrs. For sediment samples, 10 g of each pooled sediment was mixed with 90 mL of sterilized distilled water to create a 10 − ¹ dilution, which was then serially diluted up to 10 − ⁷ using 9 mL of sterile distilled water. From each dilution, 1 mL aliquot was plated onto the nutrient agar (NA; Difco, USA) using the pour plate method. All Petri dishes were incubated at 37 °C for 24–48 hrs. The results obtained were expressed as the number of colony-forming units per gram (CFU/g) of the sample [ 7 ]. A total of 117 distinct colonies were isolated from the soft tissues, gills, and sediments based on their unique morphological characteristics. All colonies were purified on nutrient agar (NA; Difco, USA) and stored on sterile NA slants at −8°C for subsequent analysis. Isolation of bacterial pathogens Serially diluted suspensions derived from bivalve tissue and sediment samples were utilized to isolate specific human pathogenic bacteria. Seven selective media were employed to enumerate and tentatively identify Vibrio spp., Salmonella spp., Shigella spp., Streptococcus spp., Klebsiella spp., coliforms, and faecal coliforms. The media included Thiosulfate-Citrate-Bile Salts-Sucrose (TCBS) agar, Xylose Lysine Deoxycholate (XLD) agar, KF Streptococcal agar, MacConkey agar, M-Endo agar, Eosin Methylene Blue (EMB) agar, and m-Faecal Coliform (MFC) agar. Pathogens isolated from these primary cultures were further subjected to Gram staining and microscopic observation following the methodology outlined by Smith and Hussey [ 28 ]. Coliform count Bivalve tissue homogenate was used for coliform enumeration. A 1 mL sample was inoculated into a 10 mL sterile Lauryl Tryptose Broth (LTB) fitted with an inverted Durham tube. The tube was incubated at 37 °C for 24 hrs and checked for gas production (presumptive test). Tubes that showed gas production (positive result) were inoculated (1 mL) into 10 mL of Brilliant Green Lactose Broth (BGLB) and incubated at 37 °C for 24 hrs (confirmatory test). The gas-positive tubes were recorded to determine the Most Portable Number (MNP) index using a standardized MPN table [ 29 ]. The positive BGLB tubes were streaked onto EMB agar plates and incubated at 37 °C and 44.5 °C for 24–48 hrs to distinguish the E. coli from the thermo-tolerant E. coli . All bacteria analyses were conducted in triplicate, the mean values were calculated and used for statistical analysis. DNA extraction and 16s rRNA gene PCR sequencing Thirty aerobic bacterial isolates were selected for 16S rRNA gene PCR sequencing. Further, bacteria were exclusively selected to facilitate functional studies such as testing antibiotic resistance or tolerance to heavy metals. DNA was extracted from the bacterial isolates following the MicroGEM bacterial extraction kit protocol ( https://microgembio.com/product/prepgem-bacteria-dna-extraction-kit/ ). The 16S rRNA gene was amplified using universal primers 27F (AGAGTTTGATCMTGGCTCAG) and 1492R (CGGTTACCTTGTTACGACTT). Purified PCR products were sequenced using the ABI Prism Sequencer 3730 (Applied Biosystems, USA). Chimera analysis of the 16S rRNA gene sequences was performed using Bellerophon software. The sequences were then compared against the eubacteria RefSeq Genome database using BLASTn to identify closely related type strains. Multiple sequence alignment was carried out with MUSCLE, as previously described by Pipite [ 30 ]. Heavy metal tolerance test All isolated heterotrophic bacterial strains were evaluated for heavy metal tolerance using the agar dilution method. This established approach allows for the simultaneous evaluation of multiple isolates against defined concentrations of antibiotics or heavy metals under controlled conditions. Each strain was individually inoculated into 10 mL of sterile nutrient agar medium supplemented with varying concentrations (1 mM, 3 mM, 5 mM, and 10 mM) of selected heavy metals. Due to Site 1’s proximity to a known effluent discharge from the sugar mill, it is likely to experience elevated levels of pollutants, including heavy metals. In this regard, the selected concentration range of heavy metals (1–10 mM) was used to assess bacterial tolerance and adaptive responses to metal stress. Zn, Cu, Cd, Cr and Pb were chosen for analysis because these metals were found at high concentrations in bivalve soft tissues from Ba River. The cultures were incubated at 37 °C for 24–28 hrs. Each Petri plate was divided into six sections, and 10 µ L of each bacterial strain was spot inoculated onto the agar surface. Control plates with streaked bacterial strains and no heavy metals were prepared for comparison. All experiments were conducted in triplicate to ensure reproducibility. Antibiotics sensitivity test The panel of antibiotics (streptomycin, penicillin, vancomycin, rifampicin, and tetracycline) was selected to represent a range of mechanisms of action, including inhibition of cell wall synthesis, protein synthesis, and RNA transcription, allowing for a comprehensive assessment of bacterial susceptibility and resistance pattern [ 31 ]. Isolated bacterial strains were individually inoculated into 10 mL of sterile nutrient agar medium, supplemented with concentrations of 25 µ g, 50 µ g, 75 µ g, and 100 µ g of each antibiotic. The cultures were incubated at 37 °C for 24–28 hrs. Each Petri plate was divided into six sections, and 10 µ L of each bacterial strain was spot-inoculated onto the agar surface. The control plates without the antibiotics, were streaked with bacterial strains and incubated under the same conditions at 37 °C for 24–48 hrs for comparison. Statistical analysis Microbial samples were analysed using single factor ANOVA. Significant results were subjected to Tukey HSD post hoc pairwise comparison test. Experimental data were collected in triplicates. All data were subjected to exploratory analysis to identify any irregularities and bias including outliers. Variables were then subjected to normality and homogeneity of variance assumptions tests as conditions for using one way ANOVA. Alpha level of p < 0.05 was selected to determine acceptable significance. Statistical analysis was performed using R version 4.3.2 [ 32 ]. Results The socioeconomic livelihoods of communities around the Ba watershed in Fiji are significantly dependent on its water and food resources, particularly the harvesting of kai bivalves for consumption and sale. Due to increasing concerns regarding the degradation of these aquatic resources, this study conducted a thorough examination of the microbial communities associated with the bivalves and river sediments. The investigation focused on microbial characterization, antibiotic sensitivity and tolerance, and heavy metal tolerance. Isolation and enumeration of aerobic bacteria from soft tissues, gills and sediments The aerobic bacteria were isolated from soft tissues, gills, and sediments. In bivalves, the maximum bacterial load was observed in the soft tissues (ranging from 7.9 × 10 3 cfu/g to 2.2 × 10 4 cfu/g), followed by the gills (3.4 × 10 3 cfu/g–1.4 × 10 4 cfu/g). Conversely, sediments recorded the lowest bacterial count (2.6 × 10 4 cfu/g to 2.9 × 10 4 cfu/g) across all sites. Statistical analysis indicated significant differences ( p < 0.05, F–value = 1.95) in bacterial load among the soft tissues, gills, and sediments at each site ( Fig 2 ). Site 1 appeared to be most heavily contaminated, exhibiting the highest aerobic bacterial loads compared to Sites 2 and 3. Site 3 showed higher bacterial loads in soft tissues and sediments than Site 2. However, these results may vary based on the season, sampling location, and bivalves’ species. Download: PNG larger image TIFF original image Fig 2. Total aerobic bacteria load in soft tissues (ST) and gills (G) of bivalves ( Batissa violacea ) and sediments (S) at different sites along the Ba River in Fiji. Different lowercase letters (a-f) denote significant differences between total microbial abundance in soft tissues, gills and sediments at 3 sites (ANOVA with Tukey HSD pairwise comparisons, p < 0.05). Vertical bars represent ± S.E. of the mean. https://doi.org/10.1371/journal.pone.0359203.g002 Human pathogenic bacteria Vibrio spp. isolation and enumeration in bivalves’ soft tissues, gills and sediments Among the soft tissues, gills, and sediments, soft tissues recorded the highest bacterial load of Vibrio spp. at Site 1 (4.0 × 10 3 cfu/g). While Vibrio spp. was present in the soft tissues and
## Related Clinical Research

- [Admission interleukin-6 and short-term prognosis in hospitalized cirrhosis: etiology-dependent, ti](https://medichelpline.com/clinical-feed/plos-one-19-admission-interleukin-6-as-a-time-limited-etiology-dependent-prognostic-signal.md)
- [Fatal Rickettsia parkeri Infection in an Immunocompromised Child — Georgia Case Report](https://medichelpline.com/clinical-feed/cdc-emerging-infectious-diseases-journal-1-fatal-rickettsia-parkeri-rickettsiosis-in-immunocompromised-pediatric-patient.md)
- [Antibacterial activity and safety of Cassia senna leaf extracts against Staphylococcus aureus and](https://medichelpline.com/clinical-feed/pubmed-42839206.md) (DOI: 10.1007/s12223-026-01609-9)
- [Helicobacter pylori immune priming depends on type I interferon signaling](https://medichelpline.com/clinical-feed/frontiers-in-immunology-12-helicobacter-pylori-induced-immune-priming-requires-type-i-interferon-signaling.md)
- [Gut complement C1q and C3 bind Clostridioides difficile spores via CdeM and promote pathogenesis](https://medichelpline.com/clinical-feed/biorxiv-19-gut-complement-c1q-and-c3-interact-with-clostridioides-difficile-spores-via.md)

## Navigation
- [← Back to Infectious Disease Feed](https://medichelpline.com/clinical-feed/infectious-disease.md)
- [← All Clinical Specialties](https://medichelpline.com/clinical-feed.md)
## Medical & Regulatory Disclaimer

> [!CAUTION]
> MedicHelpline content is structured for research, educational, and professional discovery purposes. It does not constitute individual medical advice, clinical diagnosis, or treatment recommendations.
> Always verify dosing, contraindications, and regulatory alerts against official product labeling and primary regulatory sources before clinical decision-making.