---
title: "ASNS-dependent asparagine supports intestinal ILC2 responses and type 2 immunity under nutrient li"
id: "frontiers-in-immunology-15-asns-dependent-asparagine-availability-supports-intestinal-ilc2-responses-and"
canonical_url: "https://medichelpline.com/clinical-feed/frontiers-in-immunology-15-asns-dependent-asparagine-availability-supports-intestinal-ilc2-responses-and"
content_type: "clinical_feed_article"
specialty: "Infectious Disease"
source_name: "Frontiers in Immunology"
source_url: "https://www.frontiersin.org/articles/10.3389/fimmu.2026.1878920"
published_at: "2026-09-15T00:00:00.000Z"
evidence_level: "Journal Feed"
license: "CC-BY-NC-4.0 / Informational Use"
---
# ASNS-dependent asparagine supports intestinal ILC2 responses and type 2 immunity under nutrient li
## Provenance & Clinical Metadata
- **Canonical URL:** https://medichelpline.com/clinical-feed/frontiers-in-immunology-15-asns-dependent-asparagine-availability-supports-intestinal-ilc2-responses-and
- **Specialty:** [Infectious Disease](https://medichelpline.com/clinical-feed/infectious-disease.md)
- **Primary Source:** Frontiers in Immunology
- **Source URL:** [Original Journal Publication](https://www.frontiersin.org/articles/10.3389/fimmu.2026.1878920)
- **Published At:** 2026-09-15T00:00:00.000Z
- **Evidence Rating:** Journal Feed
## Executive GIST (TL;DR)
- The source record corresponds to an article titled “ASNS-dependent asparagine availability supports intestinal ILC2 responses and type 2 immunity under nutrient-limited conditions.” - The publicly available page content provided here is site navigation and journal metadata from Frontiers in Immunology; the article’s full text, abstract, methods, results, and conclusions were not included in the provided source content. - From the title alone, the article addresses the role of **ASNS** (asparagine synthetase) in controlling local **asparagine** availability and its impact on intestinal **ILC2** (type 2 innate lymphoid cell) responses and broader **type 2 immunity** when nutrients are limited. - The title implies a focus on cellular metabolism and nutritional immunology at the intestinal mucosa, linking a metabolic enzyme to immune function during nutrient scarcity. - Specific experimental details, model systems (mouse, human, in vitro), numeric results, statistical significance, and mechanistic pathways were not reported in the provided source material. - Any hypotheses, interventions, or therapeutic implications that the authors may have reported are not available in the supplied content and therefore cannot be summarized or inferred beyond the title. - Readers should consult the full Frontiers in Immunology article for complete methods, datasets, figures, and the authors’ interpretations because critical details were not present in the source excerpt.
## Clinical Analysis & Structured Key Points
Frontiers | ASNS-dependent asparagine availability supports intestinal ILC2 responses and type 2 immunity under nutrient-limited conditions ORIGINAL RESEARCH article Front. Immunol. , 15 September 2026 Sec. Mucosal Immunity Volume 17 - 2026 | https://doi.org/10.3389/fimmu.2026.1878920 Published in Frontiers in Immunology Mucosal Immunity 7 impact factor 11.3 citescore Editor & Reviewers Edited by A V Alexei V Tumanov Reviewed by L C Laure Campillo-Gimenez J H Jorg Hermann Fritz Outline Figures and Tables Figure 1 View in article Figure 2 View in article Figure 3 View in article Figure 4 View in article Figure 5 View in article ORIGINAL RESEARCH article Front. Immunol. , 15 September 2026 Sec. Mucosal Immunity Volume 17 - 2026 | https://doi.org/10.3389/fimmu.2026.1878920 ASNS-dependent asparagine availability supports intestinal ILC2 responses and type 2 immunity under nutrient-limited conditions W T Wenyu Tian 1 X L Xuesong Liu 1 M Z Mengqi Zheng 2 J S Jing Shen 1,3 * 1. Advanced Medical Research Institute, Shandong University, Jinan, China 2. Department of Gastroenterology, Qilu Hospital of Shandong University, Jinan, China 3. Suzhou Research Institute of Shandong University, Shandong University, Suzhou, Jiangsu, China See more Article metrics View details Abstract Introduction: Nutrient availability critically governs group 2 innate lymphoid cell (ILC2) function and type 2 immunity. Here, we identify the non-essential amino acid asparagine (Asn) as a critical metabolite required for ILC2 survival and function. Methods: We investigated the roles of extracellular Asn availability and asparagine synthetase (ASNS)-mediated de novo Asn biosynthesis in ILC2 responses using complementary in vitro and in vivo approaches, including amino acid restriction, ILC2-specific Asns deletion, dietary Asn restriction, and Nippostrongylus brasiliensis infection. Results: ASNS, the rate-limiting enzyme for de novo Asn synthesis, was rapidly induced upon ILC2 activation under type 2 inflammatory conditions. When extracellular Asn was limited, ILC2s depended on ASNS-mediated Asn synthesis fueled by glutamine (Gln). Genetic ablation of Asns was well tolerated under Asnreplete conditions but severely impaired ILC2 viability and overall effector cytokine output upon Asn restriction. Dietary Asn restriction compromised ILC2s, and this effect was further aggravated by Asns deficiency. During N. brasiliensis infection, reduced intestinal Asn availability enhanced ILC2 reliance on Asns, whose deficiency impaired ILC2 abundance in the mLNs and protective anti-helminth immunity. Discussion: These findings identify Asn as a context-dependent metabolic adaptor that supports ILC2 viability and function under nutrient-limited and type 2 inflammatory conditions. Introduction Group 2 innate lymphoid cells (ILC2s) are key effectors of type 2 immunity at barrier tissues and are particularly important in the intestine, where they contribute to mucosal homeostasis, tissue adaptation, and anti-helminth defense. Upon activation by epithelial-derived cytokines such as IL-33, IL-25, and thymic stromal lymphopoietin (TSLP), ILC2s rapidly produce type 2 cytokines including IL-5 and IL-13, thereby promoting eosinophil recruitment, mucus secretion, and helminth expulsion ( 1 – 3 ). Metabolic reprogramming has emerged as a fundamental regulatory mechanism that supports ILC2 activation, expansion, tissue adaptation, and effector cytokine production ( 4 – 8 ). Upon stimulation by epithelial-derived cytokines, ILC2s rapidly increase their biosynthetic and energetic demands, which requires coordinated remodeling of nutrient uptake and intracellular metabolic pathways. Previous studies have shown that activated ILC2s undergo enhanced glycolytic activity, which supports rapid proliferation and type 2 cytokine production. In parallel, lipid metabolic programs also play important roles in ILC2 biology. Fatty acid uptake and oxidation contribute to ILC2-mediated barrier protection during malnutrition and helminth infection ( 5 ), whereas lipid-droplet formation and fatty acid handling have been linked to pathogenic ILC2 responses in allergic inflammation ( 6 ). In addition to glycolysis and lipid metabolism, several nutrient-sensing and metabolic regulatory pathways have been identified as key modulators of ILC2 function. Arginase 1 acts as an ILC2-intrinsic metabolic checkpoint that regulates type 2 inflammation ( 4 ). mTORC1 signaling integrates nutrient availability and growth signals to support ILC2 proliferation and effector function ( 9 ), whereas LKB1/AMPK-related pathways are involved in maintaining metabolic fitness and cellular homeostasis ( 10 ). HIF-1α-associated programs have also been implicated in shaping ILC2 activation and inflammatory responses under metabolically demanding conditions ( 11 ). These findings indicate that ILC2s depend on multiple interconnected metabolic pathways to sustain their activation state and tissue-specific functions. Amino acid uptake and availability represent another important layer of metabolic regulation in ILC2s. The amino acid transporter SLC7A8 has been shown to support ILC2 homeostasis and activation-dependent fitness, and amino acid availability has been proposed to act as a metabolic rheostat that determines the magnitude of ILC2 responses ( 7 , 8 ). Notably, metabolomic analyses of activated lung ILC2s revealed relative enrichment of several amino acids, including L-alanine, valine, leucine, and isoleucine, highlighting the close relationship between amino acid metabolism and ILC2 activation. Among amino acid pathways, asparagine (Asn) is of particular interest because it can be obtained either through extracellular uptake or through de novo synthesis catalyzed by asparagine synthetase (ASNS) ( 12 ), which utilizes aspartate (Asp) as the carbon source and glutamine (Gln) as the amide nitrogen donor. Asn promotes CD8 + T cell activation by coordinating extracellular Asn uptake and ASNS expression and boosting LCK signaling, whereas Asn restriction improves CD8 + T cell metabolic fitness and antitumor function via an NRF2-dependent stress response ( 13 , 14 ). Asn availability also governs germinal center B cell homeostasis ( 15 ). However, whether Asn availability and ASNS-dependent biosynthesis play comparable roles in ILC2 activation and function remains unknown. In this study, we investigated whether Asn availability and ASNS-dependent de novo Asn biosynthesis supports ILC2 survival, effector cytokine production, and type 2 immune responses. We show that ILC2 activation is coupled to early induction of Asns expression, suggesting an adaptation of Asn biosynthesis in response to type 2 inflammatory contexts. Functionally, activated and expanded ILC2s require Asn availability to maintain survival and effector cytokine production under nutrient-limited conditions. Using genetic and dietary approaches, we further show that extracellular Asn availability and endogenous Asn synthesis contribute to intestinal ILC2 homeostasis in vivo . Finally, because Nippostrongylus brasiliensis infection represents a well-established intestinal type 2 inflammatory model characterized by robust ILC2 activation, we used this model to examine whether ASNS-dependent Asn biosynthesis is associated with ILC2 responses under inflammatory conditions in vivo . Together, these findings support a context-dependent role for Asn availability and ASNS-dependent Asn biosynthesis in sustaining intestinal ILC2 responses under nutrient-limited and type 2 inflammatory conditions. Materials and methods Mice Male and female mice at the age of 6–8 weeks old were used for all animal experiments. C57BL/6 WT mice and Asns fl/fl mice (background: C57BL/6J, strain T012991) were purchased from Gempharmatech (Nanjing, China). Il5 RFP-cre/+ mice (strain 030926) was procured from The Jackson Laboratory. The Asns fl/fl mice were crossed to Il5 RFP-cre/+ mice to obtain a strain with Asns fl/fl Il5 RFP-cre/+ conditional gene deletion and Asns +/+ Il5 RFP-cre/+ WT littermates ( 16 – 18 ). All the mice were housed in specific-pathogen-free facilities in ventilated cages with ad libitum food and water at the Model Animal Research Center of Shandong University. Public transcriptomic and metabolomic data analysis Publicly available transcriptomic datasets were analyzed to evaluate the expression of Asn metabolism-related genes in ILC2s under different type 2 inflammatory conditions. GSE205669 contains bulk RNA-seq data from sorted small intestinal ILC2s stimulated with IL-25 for 48 h. E-MTAB-15989 contains bulk RNA-seq data from lung ILC2s sorted from papain-induced asthma model mice. GSE271362 contains bulk RNA-seq data from sorted small intestinal ILC2s stimulated with ADM2 for 3h. For these bulk RNA-seq datasets, raw FASTQ files were first subjected to quality control and adapter trimming using fastp (version 0.19.5). The filtered reads were then aligned to the mouse reference genome GRCm39 using STAR (version 2.7.9a). The resulting BAM files were processed with featureCounts (version 2.0.3) to generate raw gene count matrices, and differentially expressed genes were identified using DESeq2 (version 1.46.0). GSE148539 contains Affymetrix Mouse Gene 2.0 ST Array data from lung ILC2s sorted from IL-33-treated mice. The expression matrix was generated using the mogene20sttranscriptcluster.db (version 8.8.0) and pd.mogene.2.0.st (version 3.14.1) annotation packages, and differential expression analysis was performed using limma (version 3.62.2). All normalized gene expression matrix are provided as Supplementary Materials ( Supplementary Tables S1–S4 ). Isolation of immune cells from intestinal lamina propria The isolation of mouse immune cells from intestinal lamina propria was done as previously described ( 19 ). Briefly, intestines were separated and fat tissues were removed. Intestines were cut open and washed in cold PBS, and were then cut into 1 cm-long pieces. The tissues were then incubated in PBS containing 10 mM EDTA and 10 mM HEPEs with shaking 200 rpm at 37 °C for 30 min. The tissues were then digested in RPMI1640 containing FBS (5%), 1% penicillin-streptomycin, DNase I (150 U/mL, Sigma) and collagenase VIII (100 U/mL, Sigma) at 37 °C in a 5% CO 2 incubator for 1.5 h. The digested tissues were shaken and filtered through 100 μm cell strainers. Mononuclear cells were then harvested from the interphase of an 80% and 40% Percoll (Cytiva) gradient after a spin at 2500 rpm for 15 min at room temperature. After density gradient centrifugation, the cells in the intermediate layer were collected, which were identified as lamina propria lymphocytes. Flow cytometry For cytokine production, cells were stimulated ex vivo by 50 ng/mL PMA (PeproTech), 500 ng/mL Ionomycin (BioGems) for 4 h, and 2 μg/mL Brefeldin A (BioGems) was added 2 h before cells were harvested. Then cells were discriminated by Zombie Aqua Fixable Viability Kit (BioLegend) in PBS. Fc block (CD16/32) antibody was used to block the non-specific binding to Fc receptors before surface staining. Cells were stained with surface antibodies for 25 min at 4 °C. For intracellular staining, cells were incubated with Fixation/Permeabilization at 4 °C for 12 h. Then the cells were incubated with the intracellular antibodies for 2 h at 4 °C. For flow cytometric analysis, lymphocytes were first identified by FSC-A and SSC-A, followed by exclusion of doublets and dead cells. ILC2s were defined as live CD45.2 + Lin − Gata3 + or live CD45.2 + Lin − KLRG1 + cells. For cell sorting, large intestinal lamina propria ILC2s were sorted as live CD45.2 + Lin − CD127 + KLRG1 + cells. The lineage cocktail included CD3e, CD11b, CD11c, B220, CD19, CD5, Ter119, FcϵRIα, Ly6G and CD16/32. All antibodies used in this study can be found in Supplementary Table 2 . Cell culture Sorted ILC2s were cultured and expanded in indicated IMDM media (Macgene CM10016), DMEM (Macgene CM15019), and DMEM(-Gln) (Macgene CM15013) supplemented with 15% FBS, mIL-2 (10 ng/mL, PeproTech), mIL-7 (10 ng/mL, PeproTech), mIL-25 (10 ng/mL, PeproTech) and mIL-33 (10 ng/mL, PeproTech). For Asn/Asp rescue experiments, after expansion, cells were transferred into IMDM, DMEM, or DMEM(-Gln) for 48 h. For rescue experiments, Asn (28.4 mg/L) or Asp (30 mg/L) was added to the indicated media. Quantitative real-time RT-PCR Sorted and cultured ILC2s were dissolved in RNA isolation reagent (Vazyme) and total RNA was isolated. cDNA was synthesized from extracted total-RNA using Reverse Transcriptase kit (Vazyme) according to the manufacturer’s protocol. Quantitative PCR was performed with SYBR-Green premix (Vazyme) and detected by a Real Time PCR System (StepOne, Applied Biosystems). The expression levels of target gene were normalized to the housekeeping gene Gapdh . 2 −ΔΔCt was used to calculate the relative mRNA expression of target genes. All primers used in this study are as follows: Gapdh F: CATGGCCTCCAAGGAGTAAG, R: CCTAGGCCCCTCCTGTTATT; Asns F: TCCAACCGGTCTTGTCACTG, R: AACACACAGCCAGAAACCCA; Il5 F: CTCTGTTGACAAGCAATGAGACG, R: TCTTCAGTATGTCTAGCCCCTG; Il13 F: CCTGGCTCTTGCTTGCCTT, R: GGTCTTGTGTGATGTTGCTCA; Gls F: CATCCTCATCTGACGAGCGG, R: TCCTGTAGGATCTCCGAGGG; Gls2 F: CTTCCAAAAGTGTGTGAGCAGC, R: GGGATGTAGGCTGCCACTTT; Glul F: GCAGGGAAACCCTAAGCAGT, R: GCAGGGAAACCCTAAGCAGT; Got1 F: GAAGACAATGGCTGACCGGA, R: TTTGGTGGCGTGAACTACGA; Slc1a4 F: CCTGGTGTTAGGAGTGGCTC, R: AGTCACTCTGGAACAGGTCG; Slc1a5 F: TGCCTTCCGCTCTTTTGCTA, R: GACGATAGCGAAGACCACCA; Slc7a1 F: ACTGTGGAAGGGCTCATTGT, R: CCGGCTAGGACATAGACACC; Slc7a5 F: CTGACACCTGTGCCATCACT, R: TTCACCTTGATGGGACGCTC; Slc7a8 F: AGGTGGAGGCGATCTGTTTC, R: GAGTGCGCTCCTACCCTCTA; Slc38a1 F: AGGGGCATAAGGTACACCGA, R: CGTGGAGCGGACCAGTTTAT; Slc38a2 F: GCCTGTTGTTGGATTACGGG, R: GGGATCCACGTCGGCATAAT. ELISA measurement of IL-5 and IL-13 IL-5 and IL-13 concentrations in cell culture supernatants were quantified using a Mouse IL-5 ELISA Kit (MULTI SCIENCES, Hangzhou, China) and a Mouse IL-13 ELISA Kit (MULTI SCIENCES, Hangzhou, China), respectively, according to the manufacturer’s instructions. Briefly, cell culture supernatants were collected and centrifuged at 1400 × g for 10 min to remove cell debris. The clarified supernatants were aliquoted and stored at -20 °C until analysis. Before the assay, all reagents and samples were brought to room temperature. Standards were prepared by serial dilution to generate standard curves, and culture medium was used as the zero standard and dilution matrix for cell culture supernatant samples. For each assay, 100 μL of standards or cell culture supernatants was added to the pre-coated ELISA plate wells, followed by 50 μL of detection antibody working solution. The plate was sealed and incubated for 1.5 h at room temperature with gentle shaking. After washing six times with wash buffer, 100 μL of Streptavidin-HRP working solution was added to each well and incubated for 30 min at room temperature with gentle shaking. The plate was washed again, and 100 μL of TMB substrate was added to each well and incubated in the dark at room temperature for 5–30 min. The reaction was stopped by adding 100 μL of stop solution. Absorbance was measured within 30 min using a microplate reader at 450 nm, with 630 nm used as the reference wavelength. Cytokine concentrations were calculated from the corresponding standard curves. Western blotting ILC2s were lysed in RIPA lysis buffer containing protease inhibitors, and total protein concentrations were determined using a BCA protein assay kit. Equal amounts of protein were separated by SDS-PAGE and transferred onto PVDF membranes. After blocking with 5% non-fat milk at room temperature for 1 h, the membranes were incubated overnight at 4 °C with primary antibody against ASNS (Anti-Asparagine synthetase Rabbit pAb, Servicebio, 1:1000). After washing, the membranes were incubated with HRP-conjugated secondary antibody at room temperature for 1 h. ASNS protein bands were first detected at the expected molecular weight range of 55–64 kDa. After ASNS detection, the same membrane was washed and then incubated with anti-GAPDH antibody to detect the internal loading control. Protein bands were visualized using an enhanced chemiluminescence detection system and ASNS protein expression was normalized to GAPDH. Asn-deficient diet feeding Asns +/+ Il5 RFP-cre/+ and Asns fl/fl Il5 RFP-cre/+ mice were fed either a control diet (0.6% Asn, AIN76A, cat: A10021B, Jiangsu Synergy Pharmaceutical Bioengineering Co., Ltd.) or an Asn-deficient diet (0% Asn, based on AIN76A, Jiangsu Synergy Pharmaceutical Bioengineering Co., Ltd.) ( 20 ). All diets were isonitrogenous and contained similar calorie densities. All mice had ad libitum access to food and water. After three weeks, mice were sacrificed and intestinal tissues were collected. Measurements of tissue Asn Intestinal Asn levels were quantified using an HPLC-MS system with an ADME column (100 mm × 2.1 mm). Approximately 30 mg SI or LI tissue was homogenized and extracted with 500 μL acetonitrile. Subsequently, 10 μL internal standard (IS) working solution ( 13 C 10 15 N 5 -GMP, 1 μg/ml, 10 μL) and 50 μL methanol–water (5:95, v/v) were sequentially added to the tissue lysate. The mixture was vortexed, followed by centrifuged at 12000 g for 20 min. A total of 400 μL supernatant was transferred to a new 1.5 mL tube and vacuum-dried to complete dryness at 30°C using a vacuum concentrator. The residue was reconstituted in 150 μL of initial mobile phase for instrumental detection. Asn was detected in positive ion mode. The mobile phase contained solvent A (0.1% formic acid, FA) and solvent B (acetonitrile), with the gradient elution schedule detailed below: 0–3 min, 99% A; 3–4 min, 99–5% A; 4–6 min, 5% A; 6.1–8 min, 99% A. Respective standards were used to generate standard calibration curves. Samples were analyzed on a Qtrap 5500 (AB Sciex) system. Nippostrongylus brasiliensis infection model For Nippostrongylus brasiliensis infection, L3 worms were obtained by the fecal culture method as described previously ( 21 ). Each mice received 500 L3 by s.c. injection. For intestinal worms’ recovery, small intestines were removed 5 days post-infection, placed in PBS and split longitudinally with sharp scissors. Then incubate samples for 2 h at 37 °C in a 50-mL centrifuge tube containing PBS, viable worms will collect at the bottom and total worms’ numbers were then counted using a dissecting microscope. Statistical analysis Data are presented as the mean ± SD. Statistical analyses were performed using GraphPad Prism 10. For comparisons between two groups, the Mann-Whitney test was used. For comparisons among three or more groups, normality and homogeneity of variance were first assessed, and datasets included in parametric analyses met the assumptions of normal distribution and equal variance. Depending on the experimental design, ordinary one-way ANOVA followed by Tukey’s multiple comparisons test or ordinary one-way ANOVA followed by Dunnett’s multiple comparisons test was used. For datasets involving two independent factors, ordinary two-way ANOVA followed by Tukey’s multiple comparisons test was performed. A p value < 0.05 was considered statistically significant and is indicated as follows: *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001. Detailed statistical information for each experiment is provided in the corresponding figure legends. Results ILC2 activation is associated with induction of the Asn biosynthetic enzyme ASNS across type 2 inflammatory contexts Asn derives from extracellular uptake or Asns -mediated biosynthesis from Asp and Gln ( Figure 1A ). To investigate how Asn metabolism is regulated during ILC2 activation, we isolated LI lamina propria ILC2s ( Supplementary Figure 1A ) and stimulated them in vitro with mIL-2, mIL-7, mIL-25 and mIL-33 ( Figure 1B ). Quantitative real-time PCR (qPCR) analysis showed that Asns expression was
## Related Clinical Research

- [Contextual factors affecting routine immunisation delivery in Mumbunda Health Zone, DRC — head nur](https://medichelpline.com/clinical-feed/medrxiv-2-contextual-factors-shaping-the-delivery-of-routine-immunisation-services-in-the.md)
- [Kennedy renews attacks on vaccines at Children’s Health Defense conference](https://medichelpline.com/clinical-feed/stat-news-1-kennedy-renews-attacks-on-vaccines-at-children-s-health-defense-conference.md)
- [CCL26 as a Core Comorbid Gene and Biomarker for Atopic Dermatitis and Allergic Asthma — Machine Le](https://medichelpline.com/clinical-feed/frontiers-in-immunology-10-identification-and-experimental-validation-of-ccl26-as-a-core-comorbid-gene-and.md)
- [Allergic airway inflammation alters coronavirus outcomes: protection for SARS-CoV-2 and MERS-CoV,](https://medichelpline.com/clinical-feed/biorxiv-21-allergic-airway-inflammation-protects-against-sars-cov-2-and-mers-cov-disease.md)
- [Respiratory viruses trigger ferroptosis-like lipid peroxidation and mitochondrial remodeling in lu](https://medichelpline.com/clinical-feed/pubmed-42663456.md) (DOI: 10.1128/spectrum.01957-26)

## Navigation
- [← Back to Infectious Disease Feed](https://medichelpline.com/clinical-feed/infectious-disease.md)
- [← All Clinical Specialties](https://medichelpline.com/clinical-feed.md)
## Medical & Regulatory Disclaimer

> [!CAUTION]
> MedicHelpline content is structured for research, educational, and professional discovery purposes. It does not constitute individual medical advice, clinical diagnosis, or treatment recommendations.
> Always verify dosing, contraindications, and regulatory alerts against official product labeling and primary regulatory sources before clinical decision-making.